{"id":34088,"date":"2024-11-01T09:24:01","date_gmt":"2024-11-01T09:24:01","guid":{"rendered":"http:\/\/atmokpo.com\/w\/?p=34088"},"modified":"2024-11-01T10:53:27","modified_gmt":"2024-11-01T10:53:27","slug":"c-coding-test-course-dna-password","status":"publish","type":"post","link":"https:\/\/atmokpo.com\/w\/34088\/","title":{"rendered":"C# Coding Test Course, DNA Password"},"content":{"rendered":"

<\/p>\n

\n Coding tests are an essential element for employment, and the ability to effectively solve algorithmic problems can leave a good impression on interviewers. In this course, we will explore a problem titled ‘DNA Password’ and explain the solution process step by step. The DNA password includes concepts of pattern recognition, string processing, and optimization, which often appear in algorithmic problems.\n<\/p>\n

Problem Description<\/h2>\n

\n The DNA password problem is to find out how many passwords of a given length exist within a specific DNA sequence. A DNA string consists of four characters: ‘A’, ‘C’, ‘G’, and ‘T’. We need to take the given DNA sequence and the length of the password as inputs and output how many times this password appears.\n<\/p>\n

Problem Definition<\/h3>\n
\n\nProblem: DNA Password\nInput: \n1. DNA Sequence (string)\n2. Password Length (integer)\n\nOutput: \nPrint how many times all strings of the given password length appear in the sequence.\n<\/code>\n<\/pre>\n
Solution Process<\/h2>\n
Step 1: Understanding the Problem<\/h3>\n
\n    The goal is to extract all possible passwords of varying lengths from the DNA string based on the given input and count their frequencies. This problem can be optimized using the sliding window technique and a hash map.\n<\/p>\n
Step 2: Understanding the Sliding Window<\/h3>\n
\n    The sliding window is a useful technique for handling continuous subarrays (or substrings). To search for passwords within a string using a fixed-size window, we continuously move the current position of the window, adding new values and removing old ones to maintain the current state. This allows us to solve the problem with a time complexity of O(N).\n<\/p>\n
Step 3: Utilizing the Hash Map<\/h3>\n
\n    We can use a hash map to count and update the frequency of passwords. This structure is advantageous for quickly checking and modifying the frequency of each password when it appears.\n<\/p>\n
Step 4: Implementing<\/h3>\n
\n    Now, let’s write the actual C# code. The code below calculates the frequency of DNA passwords based on the given input.\n<\/p>\n
\n\nusing System;\nusing System.Collections.Generic;\n\npublic class DnaPassword\n{\n    public static int CountDnAPasswordOccurrences(string dna, int passwordLength)\n    {\n        if (dna.Length < passwordLength || passwordLength <= 0)\n            return 0;\n\n        Dictionary passwordCount = new Dictionary();\n        \/\/ Initializing for sliding window\n        for (int i = 0; i <= dna.Length - passwordLength; i++)\n        {\n            string password = dna.Substring(i, passwordLength);\n            if (passwordCount.ContainsKey(password))\n            {\n                passwordCount[password]++;\n            }\n            else\n            {\n                passwordCount[password] = 1;\n            }\n        }\n        \n        \/\/ Output results\n        foreach (var entry in passwordCount)\n        {\n            Console.WriteLine($\"Password: {entry.Key}, Count: {entry.Value}\");\n        }\n\n        return passwordCount.Count; \/\/ Return the number of unique passwords\n    }\n\n    public static void Main(string[] args)\n    {\n        Console.WriteLine(\"DNA Password Program\");\n        string dnaSequence = \"ACGTACGTAGCTAGCTAGCTAGC\"; \/\/ Example DNA sequence\n        int passwordLength = 3; \/\/ Password length\n        int uniqueCount = CountDnAPasswordOccurrences(dnaSequence, passwordLength);\n        Console.WriteLine($\"Number of unique passwords: {uniqueCount}\");\n    }\n}\n<\/code>\n<\/pre>\n
Step 5: Code Explanation<\/h3>\n
\n    The above code finds passwords of the given length within the provided DNA string, counts their frequencies, and outputs the results.\n<\/p>\n